produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
This two python programs can convert km to miles and miles to km

km-to-miles These two little python programs can convert kilometers to miles and miles to kilometers Needed Python3 or a online python compiler with t

Chandula Janith 3 Jan 30, 2022
Random Number Generator Analysis With Python

Random-Number-Generator-Analysis Governor's Honors Program Project to determine

Jack Prewitt 2 Jan 23, 2022
Import the module and create an object of the class LocalVariable.

LocalVariable Import the module and create an object of the class LocalVariable. Call the save method with the name and the value of a variable as arg

Sajedur Rahman Fiad 2 Dec 14, 2022
A monitor than send discord webhook when a specific monitored product has stock in your nearby pickup stores.

Welcome to Apple In-store Monitor This is a monitor that are not fully scaled, and might still have some bugs.

5 Jun 16, 2022
This is a package that allows you to create a key-value vault for storing variables in a global context

This is a package that allows you to create a key-value vault for storing variables in a global context. It allows you to set up a keyring with pre-defined constants which act as keys for the vault.

Data Ductus 2 Dec 14, 2022
Convert any-bit number to decimal number and vise versa.

2deci Convert any-bit number to decimal number and vise versa. --bit n to set bit to n --exp xxx to set expression to xxx --r to run reversely (from d

3 Sep 15, 2021
A python tool give n number of inputs and parallelly you will get a output by separetely

http-status-finder Hello Everyone!! This is kavisurya, In this tool you can give n number of inputs and parallelly you will get a output by separetely

KAVISURYA V 3 Dec 05, 2021
Python type-checker written in Rust

pravda Python type-checker written in Rust Features Fully typed with annotations and checked with mypy, PEP561 compatible Add yours! Installation pip

wemake.services 31 Oct 21, 2022
A fixture that allows runtime xfail

pytest-runtime-xfail pytest plugin, providing a runtime_xfail fixture, which is callable as runtime_xfail(), to allow runtime decisions to mark a test

Brian Okken 4 Apr 06, 2022
Manage your exceptions in Python like a PRO

A linter to manage all your python exceptions and try/except blocks (limited only for those who like dinosaurs).

Guilherme Latrova 353 Dec 31, 2022
A functional standard library for Python.

Toolz A set of utility functions for iterators, functions, and dictionaries. See the PyToolz documentation at https://toolz.readthedocs.io LICENSE New

4.1k Dec 30, 2022
Cardano Stakepools: Check for scheduled blocks in current epoch.

ReLeaderLogs For Cardano Stakepool Operators: Lightweight Scheduled Blocks Checker for Current Epoch. No cardano-node Required, data is taken from blo

SNAKE (Cardano Stakepool) 2 Oct 19, 2021
A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python.

Introduction A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python. Requirements Python =3.7.3 Pika ==1.2.0 Aio-pika

Dali Kewara 1 Feb 05, 2022
A collection of utility functions to prototype geometry processing research in python

gpytoolbox This repo is a work in progress and contains general utility functions I have needed to code while trying to work on geometry process resea

Silvia Sellán 73 Jan 06, 2023
Two fast AUC calculation implementations for python

fastauc Two fast AUC calculation implementations for python: python-based is approximately 5X faster than the default sklearn.metrics.roc_auc_score()

Vsevolod Kompantsev 26 Dec 11, 2022
Protect your eyes from eye strain using this simple and beautiful, yet extensible break reminder

Protect your eyes from eye strain using this simple and beautiful, yet extensible break reminder

Gobinath 1.2k Jan 01, 2023
Simple code to generate a password for your account!

Password-Generator Simple code to generate a password for your account! Password Generator for passwords for your accounts or anything else! This code

DEEM 1 Jun 05, 2022
A simple python implementation of Decision Tree.

DecisionTree A simple python implementation of Decision Tree, using Gini index. Usage: import DecisionTree node = DecisionTree.trainDecisionTree(lab

1 Nov 12, 2021
The git for the Python Story Utility Package library.

SUP The git for the Python Story Utility Package library. Installation: Install SUP by simply running pip install psup in your terminal. Check out our

Enoki 6 Nov 27, 2022
Report Bobcat Status to Google Sheets

bobcat-status-reporter Report Bobcat Status to Google Sheets Why? I recently relocated my miner from my root into the attic. Bobcat recommends operati

Jasmit Tarang 3 Sep 22, 2021