Hello Urminder!

Something strange happens to me when I try to run orfipy with a particular genome.

At the end of the program, it does not return the predicted ORFs.

$ orfipy cdiff.fasta orfipy version 0.0.3 Using translation table: Standard (transl_table=1) start: ['TTG', 'CTG', 'ATG'] stop: ['TAA', 'TAG', 'TGA'] Setting chunk size 714 MB. Procs 45 Logs will be saved to: orfipy_cdiff.fasta_out/orfipy_2021_03_04_13_16_06.031643.log Processing 8597268 bytes Processed 1 sequences in 0.39 seconds

I tested using prodigal and it works without problems. Is the only genome that I have this problem and I can't understand why.

Can you reproduce the error? Best regards! Enzo.

cdiff.fasta.gz

I created a new environment to install orfipy, but still have conflicts error.

Collecting package metadata (current_repodata.json): done
Solving environment: failed with initial frozen solve. Retrying with flexible solve.
Solving environment: failed with repodata from current_repodata.json, will retry with next repodata source.
Collecting package metadata (repodata.json): done
Solving environment: failed with initial frozen solve. Retrying with flexible solve.
Solving environment: |
Found conflicts! Looking for incompatible packages.
This can take several minutes.  Press CTRL-C to abort.
failed

UnsatisfiableError:

Hi,

Small thing, when running orfipy on a gzip fastq file I ran into this:

Traceback (most recent call last):
  File "/home/ben/e/orfipy-0.0.2/bin/orfipy", line 11, in <module>
    sys.exit(main())
  File "/home/ben/e/orfipy-0.0.2/lib/python3.8/site-packages/orfipy/__main__.py", line 338, in main
    orfipy.findorfs.main(infile,
  File "/home/ben/e/orfipy-0.0.2/lib/python3.8/site-packages/orfipy/findorfs.py", line 479, in main
    seqs = Fasta(infasta)
  File "/home/ben/e/orfipy-0.0.2/lib/python3.8/site-packages/pyfaidx/__init__.py", line 996, in __init__
    self.faidx = Faidx(
  File "/home/ben/e/orfipy-0.0.2/lib/python3.8/site-packages/pyfaidx/__init__.py", line 354, in __init__
    raise ImportError(
ImportError: BioPython >= 1.73 must be installed to read block gzip files.

I suppose this can be fixed by specifying a biopython version constraint in the conda definition? Thanks.

Hello, have you developed a way to allow a certain size of overlaps between ORFs in order to maximize the density of longest ORFs along scaffolds?

Tanks you very much for this soft by the way, very efficient and easy to use.

All the best

Ben

I'm trying to understand how this tool works.

Here is a sequence of ~1 kb length:

region_of_interest GACTCGGTGCTATGTTCTGAATATTTCTGACTTGCATTTTTAATGGAGATAAAATGAAGCATTTAATACATGACGTAGATGAAGACATGAATGAAACTACAGACAAACTTAACTCTTCTCTCATTCTTCCTTTCAGTAAGGACTATGAGTTCTGTTCAAATGGCGTTTATTTCTATTGTGGAAAGATGGGTTCAGGTAAGACATTTAATTTAATTCGTCATATACTCATAACAGAACGTTTAGGAAATGACTCATATTATGACCAAATCATTATATCAGCAACTTCAGACTCTATGGACTCAACAGCGAAAACATTTATGTCAAAAGTTCAAGCCTCTGTCGTTAAAGTTCCAGACAGTGAACTCATTGAATTTCTTCAACGTTACATTCGACGTAAGAGGAAATATTATGCCATCGTTGAATTTATACAGTCAGGAATGCAAAAGACTTCTGAGGAGATGGAAAGAATTATTGACAAACACCACTTACGTCAGTACTCAGGAGTTTACGATATGAAACGACTGACAAACTACATTCTATCAAAACTTTCAAAATACCCCTTCAAAAAATATCCTTCAAACACTCTGCTCGTTTGCGACGACTTCGCTGGTAAAGGTTTAGTGTCAAAACCAGACTCACCATTAGCTAATATCATTACTAAAGTCAGACATTACCACTTAACTGTAGCAATACTTATGCAAACATGGAGGTTTTTAGCTTTAAACATAAAACGTCTCATAACTGACTTCGTTATCTTTCAAGGTTTCTCACGTTATGATATTGAACTCATTTGGAAACAGTCAGGTATAACATTACCTTTTGAAGAAATTTGGGAAGCATATAAGTCTCTCATCTCTCCTCGTTCATACCTTGAGATTCATATCATGACTAATACCATTAAAGTCAAAAATATTCCATGGGAACGACCAACATTGTTTTAAAGTTTAACCTTCAATTGACTGA

In the IGV genome viewer, where ATG = green bar and stop codon = red, the forward sequence appears thus with 3-frame translation:

I note 10 start sites in frame 3, following the first STOP. Each of these, I thought, would constitute an alternate ORF, all ending in the same downstream STOP

But the output of orfipy is : // $ orfipy new_seq.fa --min 100 --max 100000 --procs 4 | sort -k2,2n orfipy version 0.0.4 Using translation table: Standard (transl_table=1) start: ['TTG', 'CTG', 'ATG'] stop: ['TAA', 'TAG', 'TGA'] Setting chunk size 12053 MB. Procs 4 Logs will be saved to: orfipy_new_seq.fa_out/orfipy_2021_09_01_15_35_34.526156.log Processed 1 sequences in 0.02 seconds

region_of_interest 26 938 ID=region_of_interest_ORF.3;ORF_type=complete;ORF_len=912;ORF_frame=3;Start:CTG;Stop:TAA 0 + region_of_interest 90 210 ID=region_of_interest_ORF.1;ORF_type=complete;ORF_len=120;ORF_frame=1;Start:ATG;Stop:TAA 0 + region_of_interest 246 513 ID=region_of_interest_ORF.2;ORF_type=complete;ORF_len=267;ORF_frame=1;Start:ATG;Stop:TGA 0 + region_of_interest 323 431 ID=region_of_interest_ORF.4;ORF_type=complete;ORF_len=108;ORF_frame=-2;Start:CTG;Stop:TGA 0 - region_of_interest 532 667 ID=region_of_interest_ORF.5;ORF_type=complete;ORF_len=135;ORF_frame=-3;Start:CTG;Stop:TAG 0 - // Can you explain why orfipy excluded so many potential ORFs here? And is there an option to force it to report them?

Hello Urminder!

Amazing work! I didn't think that Cython could reach such speed. I will keep it in mind for my next projects.

I wanted to report that conda fails to install orfipy when you have Python 3.9 installed. I strongly believe that orfipy should not have problems in Python 3.9.

Do you plan to enable Python 3.9 support in the conda recipe?

Best regards! Enzo.

Hello @urmi-21 Thanks for the tool. I installed it successfully. However, it does not work. I get the following output for the command:- orfipy -h

Can you please suggest a solution?

Hi,

Is there a tool to update gtf/gff(generated by stringtie2 or scallop2) file according to orfipy results? Add splice sites, UTRs, CDSs to existing gtf/gff file.

Best, Kun

Hi, I am using the orfipy. It sounds great tool for my recent work. I wonder could it be possible only to get full length orf not the partial orfs? Please let me know if there is any possibility?

You can reproduce the problem by running the following code

import orfipy_core
seq = '''GTATCGCTGGAGTCGGGTGATCTCCACGGAGACTCGAGTGGTCTCTTCTTGCCGGGAGCCGTCTTCGCCGGGGTTTCCTCTACCAGACCAAAGGGCTCTAGGACCCTCTTTTTGGCCTGGAAAACCGCCTTACCGAGGTTTCCGCCCCAAGACTTATCGTCCTGGAGCTTTTCCTGAAACTCGGAATCGGCGTGGTTGTACTTGAGGTAAGGATTATCCCCCGCCTCAAGTAGCTTGTTGTATTCGAGATCGTGCTCTCGCGCGACCTCGTCCGCCTTATTGACGGGCTGGCCTTTATCAAGGCCGTTGAAGGGTCCGAGGTATTTGTACCCCGGAACTACTAGACCGCGTTGGTCCTGTTTTTGCTGGTTAGCCTTAGGCCGAGGCGCACCTATGGGCGATGCACAACAGGGTTCCGACGGAGTGGGCAATGCCTCGGGAGATTGGCATTGCGATTCCCAGTGGATGGGCGACCGAGTCATCACCAAGTCCACCCGAACCTGGGTGCTGCCCAGCTACAACAACCACATCTACAAGGAAATCAACTCCACCGGCAACGGACTCAACGGCAGCGCCTACTTTGGATACAGTACTCCCTGGGGATATTTCGACTTTAACCGCTTCCACAGCCACTGGAGCCCCCGAGATTGGCAGCGACTCATCAACAACCACTGGGGCTTCAGACCCAAGGCCATGCACGTCAAAATCTTCAACATCCAAGTCAAAGAAGTCACCACCCAGGACCAGACCACCACCGTCGCCTACTTTGGATACAGTACTCCCTGGGGATATTTCGACTTTAACCGCTTCCAC'''
orfipy_core.orfs(seq, starts=['ATG'])
orfipy_core.orfs(seq, starts=['ATG'], strand='f')

The following statement orfipy_core.orfs(seq, starts=['ATG']) runs without any errors. However, orfipy_core.orfs(seq, starts=['ATG'], strand='f') throws IndexError. Posting the stacktrace also

Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
  File "orfipy/orfipy_core.pyx", line 28, in orfipy_core.orfs
  File "orfipy/orfipy_core.pyx", line 46, in orfipy_core.orfs
IndexError: list index out of range

Kindly look into this. Thanks in advance :)

Hello, I'm using orfipy for viral detection. I have a range of codon table numbers I'd like to run. Looks like --table only takes a single integer, and the json file only accepts a single . Please correct me if I'm wrong about this! Would be convenient to add an option to search multiple codon tables at the same time. In its current state, I have to run orfipy multiple times and combine the results. Brett

Right now ORFs are numbered, which causes problems on subsequent runs with slightly changed parameters such as a different minimum length. Maybe encoding the start and stop position would be a better approach so that the order doesn't affect anything. Thanks!

Hello,

I believe that the description of each ORF would be more accessible as a dictionary, instead of a string that is delimited with ;, :, and =. I am able to convert the string into a desirable dictionary

{'ID': '1', 'ORF_type': 'complete', 'ORF_len': '912', 'ORF_frame': '1', 'Start': 'TTG', 'Stop': 'TAA'}

through the following code

import orfipy_core

for start, stop, strand, description in orfipy_core.orfs(mers_sequence.upper()):
    descriptions = {}
    for info in description.split(';'):
        if '=' in info:
            info = info.split('=')
            name, content = info[0], info[1]
            if name == 'ID':
                content = content.split('.')[1]
        else:
            info = info.split(':')
            name, content = info[0], info[1]
        descriptions[name] = content

however, this functionality would be more conveniently integrated into the basic code of ORFIpy.

Thank you, Andrew